Here are the sequences sent from Macrogen in Korea. There is one .txt file and one .ab1 file for each sequence. Files are designated by group-strain-PCR primer ie 1BG1 is group 1's insert generated from B. globigii with forward primer A1. You can use the txt file to cut and paste into any other program you wish - ie to get a print out so you identify the vector sequences, insert sequence, primer sequences and restriction sites used to clone the fragment as requested in the lab manual. You can also cut and paste parts of it into Blast. I would also suggest that you download the chromas.exe program on this site and use it to look at the .ab1 file of the sequences. This is the file that the abi sequencing machine puts out. The chromas program is very small and very handy. You do not have to print out the traces for your report, but you should look at them on your computer screen to see how the first bit of sequence is a little messy and then gets quite clean and then gets messy again at the end. Don't try to print out the traces unless you have colour printer. I will leave my printouts outside my office door for you to look at. REVISED INSTRUCTIONS for your report It seems that all four of Bacillus species' genomes that were once only in the unfinished microbial genome data base have now been included in the main Genbank data base (now that they are completed and annotated). So there is no reason to search the microbial database separate from the main data bank. Just do your searchs on the main data base. TO REDUCE THE NUMBER OF NON-RELEVANT HITS -THERE IS AN OPTION BELOW THE WINDOW INTO WHICH YOU PASTE YOUR SEARCH SEQUENCE WHICH WILL ALLOW YOU TO CHOOSE ONLY BACTERIAL SEQUENCES. Select this option. What I would like for your report is for you to do both BlastN and BlastX searches of the main Genbank data base (bacterial genomes only)with YOUR SEQUENCE AND TWO OTHER SEQUENCES that were generated using the same PCR primers (A1 or A2) that you used to generate your cloned PCR fragment. If you are doing A1's, make 3BTh-1 or 5BMg-1 one your choices. Add to your comments on the alignments answers to the following question: Comment on the level of sequence identity detected by blastN vs blasX and how it has affected your ability to detect matches with the more divergent(from B. subtils) species such as B. megaterium or B. halodurans There are 4 Bacillus species' genomes in the main data bank. Were the top four hits always one of these species? I have looked at the sequences and noticed a few things: the sequence of the Arev PCR primer should read: 5' CTGCAAGCTTCGGCAATGCGCGGTTTT 3' note: the nucleotide at position 11 (from the 5' end) is a C as shown above, not a T as shown in the lab manual. the first 4 bases at the 5' end will not be seen, but rather will be the sequence of the vector next to the HindIII site for some reason both of the pairs of A's in the Rev primer sometimes show up as a single A in the sequence print out. If you look closely at the traces drawn by the chromas program the green A spike corresponding to each of these A's is fatter than the other spikes surrounding it suggesting that it may represent 2 A's (this is why you should always look at the traces when there are questions about a sequence) Remember: when reading your sequence from right to left, you may find either the Arev or A1 or A2 forward PCR primer sequence following the restriction site used for cloning, depending on which fragment you cloned and in which orientation the fragment inserted. The first PCR primer sequence you read in your sequence will be in the orientation seen in the lab manual while the PCR primer sequence at the other end of the insert will be the reverse, complement of the sequence seen in the lab manual. Group 2's BMg-2 appears to be BMg-1. Group 9's had insufficient DNA to sequence.